Soybean Tissue Culture and Genetic Engineering Center Sponsored by USB
Members
Literature
Outputs

View Developing Embryos Animation




 
Index:

Event numbering system

R4JKOH02P05-T1001-050-
S4JXOH18P55-T1003-

R or S = RKN or SCN construct number
JK = Jack; WM= Williams 82, JX = Jack x PI 417138
OH = Ohio, GA = Georgia, IL = Illinois, KY = Kentucky, KS = Kansas
01 = 2 digit event numbering system - up to 20
P03 = 2 digit plant number

Universal primers

GmubiF: 5' - GCGGGCCCAATATAACAACGAC
FAD3IN_R: 5' - GATGTATAAAGAAAGTGTGAGAGTGAGATTACCATT
FAD3IN_F: 5' -CTTTATACATCGCACACCAGTGTG
rbcst R: 5' - CCGCGGATTGATGCATGTTGTCA

Reaction conditions:

  • Promega Go-Taq polymerase, 16 µl reactions with 10 ng genomic DNA or 180 fg plasmid DNA (ca. 3 copy equivalents)
  • 4 min at 94C
  • 40 cycles of 30 s at 94C, 30 s at 54C, 90 s at 72C
  • Final extension of 7 min at 72C

Information for shipping permits

mail.gif - 1330 Bytes Text for design protocol letter

Promoters:

  • SCN 1-8 and RKN 4-8 - soybean Gmubi (EU310508)
  • RKN 1-4 - tobacco Cel7 (DQ156498)

    • Intron: soybean FAD3 (DQ672337)
    Terminator: pea rubisco small subunit (X00806)

    Selectable marker
    Promoter: potato ubi3 (L22576)
    Marker: E. coli gene aph(4) (V01499)
    Terminator: potato ubi3 (L22576)

    Vector backbone: pSMART HC-Kan from Lucigen (GenBank AF532107).

    Name Construct Name Gene GenBank Recipient lab
    Cyst constructs
    pSCN1 p16B09iUH2 16B09 AF490246 Mitchum
    pSCN2 p18H08iUH2 18H08 AF490248 Baum
    pSCN3 p20E03iUH2 20E03 AF490251 Davis
    pSCN4 p23G12iUH2 23G12 AF500033 Davis
    pSCN5 p28B03iUH2 28B03 AF500025 Baum
    pSCN6 p30C02iUH2 30C02 AF502393 Davis
    pSCN7 p30D08iUH2 30D08 AF500027 Mitchum
    pSCN8 p33A09iUH2 33A09 AY125963 Mitchum
    Root-knot constructs
    pRKN1 p2E07i7H2 2E07 AF531160 Hussey
    pRKN2 p7A01i7H2 7A01 AF531165 Hussey
    pRKN3 p7E12i7H2 7E12 AF531166 Hussey
    pRKN4 p7H08i7H2 7H08 AF531168 Hussey
    pRKN5 p8H11i35H2 8H11 AF531170 Hussey
    pRKN6 p5C03BiUH2 5C03B AF531164 Hussey
    pRKN7 p9H10iUH2 9H10 AF531167 Hussey
    pRKN8 p30H07iUH2 30H07 AY134439 Hussey

    Information for mailing containers

    7CFR340.8 Requirements for containers for seed shipments:
    (2) Seeds. All seeds shall be transported in a sealed plastic bag of at least 5 mil thickness, inside a sealed metal container, which shall be placed inside a second sealed metal container. Shock absorbing cushioning material shall be placed between the inner and outer metal containers. Each metal container shall be independently capable of protecting the seeds and preventing spillage or escape. Each set of metal containers shall then be enclosed in a sturdy outer shipping container constructed of corrugated fiberboard, corrugated cardboard, wood, or other material of equivalent strength.

  • These are sold by Fisher as Biohazard Mailers. Depending on the size, the catalog numbers are 03-523-2, -4, -5, -7, or -8.

    Lila's instructions for tissue harvest

    pdfview.gif - 478 Bytes